View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13150_high_18 (Length: 241)

Name: NF13150_high_18
Description: NF13150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13150_high_18
NF13150_high_18
[»] chr8 (2 HSPs)
chr8 (1-164)||(24412831-24412994)
chr8 (8-79)||(24406300-24406371)


Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 24412831 - 24412994
Alignment:
1 cctatatgaacttacatgccagaatgtagtagaatctatcaaggataagacggtggaggaggttcgccagattttcaatattggggaatatgacttcact 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24412831 cctatatgaacttacatgccagaatgtagtagaatctatcaaggataagacggtggaggaggttcgccagattttcaatattggggaatatgacttcact 24412930  T
101 ccggaggaaaaggcggcagttcgtgaggaacgcagttggtccagtcggtcttttgaatgattat 164  Q
    ||||||||| |||||||||||||| |||||| ||||||||||||||||||||||||||||||||    
24412931 ccggaggaagaggcggcagttcgtaaggaactcagttggtccagtcggtcttttgaatgattat 24412994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 8 - 79
Target Start/End: Complemental strand, 24406371 - 24406300
Alignment:
8 gaacttacatgccagaatgtagtagaatctatcaaggataagacggtggaggaggttcgccagattttcaat 79  Q
    ||||||||||||||| |||||| |||| |||||||||||||||||||||||||| ||||| | |||||||||    
24406371 gaacttacatgccaggatgtagcagaaactatcaaggataagacggtggaggagattcgcaaaattttcaat 24406300  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University