View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13150_high_18 (Length: 241)
Name: NF13150_high_18
Description: NF13150
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13150_high_18 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 24412831 - 24412994
Alignment:
| Q |
1 |
cctatatgaacttacatgccagaatgtagtagaatctatcaaggataagacggtggaggaggttcgccagattttcaatattggggaatatgacttcact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24412831 |
cctatatgaacttacatgccagaatgtagtagaatctatcaaggataagacggtggaggaggttcgccagattttcaatattggggaatatgacttcact |
24412930 |
T |
|
| Q |
101 |
ccggaggaaaaggcggcagttcgtgaggaacgcagttggtccagtcggtcttttgaatgattat |
164 |
Q |
| |
|
||||||||| |||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
24412931 |
ccggaggaagaggcggcagttcgtaaggaactcagttggtccagtcggtcttttgaatgattat |
24412994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 8 - 79
Target Start/End: Complemental strand, 24406371 - 24406300
Alignment:
| Q |
8 |
gaacttacatgccagaatgtagtagaatctatcaaggataagacggtggaggaggttcgccagattttcaat |
79 |
Q |
| |
|
||||||||||||||| |||||| |||| |||||||||||||||||||||||||| ||||| | ||||||||| |
|
|
| T |
24406371 |
gaacttacatgccaggatgtagcagaaactatcaaggataagacggtggaggagattcgcaaaattttcaat |
24406300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University