View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13151_high_1 (Length: 236)
Name: NF13151_high_1
Description: NF13151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13151_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 41 - 219
Target Start/End: Complemental strand, 14933620 - 14933447
Alignment:
| Q |
41 |
gtagtgagacttagaatcatgtcatgtactcatgtgtggtttgcatgcttcattactcaaatattggaactggattatctatgatcttattgttttttga |
140 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14933620 |
gtagtgagacttagaatcatgt-----actcatgtgtggtttgcatgcttcattactcaaatattggaactggattatctatgatcttattattttttga |
14933526 |
T |
 |
| Q |
141 |
catgctttgtacttgatcttgtttaattggctgggaagtatttacaagtcttataatacctaaatgatagggcacatct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14933525 |
catgctttgtacttgatcttgtttaattggctgggaagtatttacaagtcttataatacctaaatgatagggcacatct |
14933447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University