View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13151_low_2 (Length: 209)
Name: NF13151_low_2
Description: NF13151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13151_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 1 - 198
Target Start/End: Original strand, 6860980 - 6861177
Alignment:
| Q |
1 |
ttgttaacgcataagcaagcttcacatcttttttacatacagaaaacatcnnnnnnncactacaatgttccaaagaaagcttcacatacccttaacatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6860980 |
ttgttaacgcataagcaagcttcacatcttttttacatacagaaaacatctttttttcactacaatgttccaaagaaagcttcacatacccttaacatga |
6861079 |
T |
 |
| Q |
101 |
tgatgagttgtatctaggatagtgtttatgcagaaattatatgcacttttcaccaaatacttgacatattattctatcttccaaattctctgctcctc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6861080 |
agatgagttgtatctaggatagtgtttatgcagaaattatatgcacttttcaccaaatacttgacatattattctatcttccaaattctctgatcctc |
6861177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University