View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13155_high_5 (Length: 341)
Name: NF13155_high_5
Description: NF13155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13155_high_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 280; Significance: 1e-157; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 280; E-Value: 1e-157
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 48485619 - 48485307
Alignment:
| Q |
1 |
actattcttttgcttgtttaatgtccctggtccaaaattttatgtaagatgactggctggttatttgatgcaggatctggaaaatatagattactattgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48485619 |
actattcttttgcttgtttaatgtccctggtccaaaattttatgtaagatgactggctggttatttgatgcaggatctcgaaaatatagattactattgc |
48485520 |
T |
|
| Q |
101 |
ccagattgcaagggaaagtcggattgtaagttatccacatcacaaacatacaaatcaaaaatcaagtatgtagtaattattatcacttctgtttcccata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48485519 |
ccagattgcaagggaaagtcggattgtaagttatccacatcacaaacatacaaatcaaaaatcaagtatgtagtaattattatcacttctgtttcccata |
48485420 |
T |
|
| Q |
201 |
cctgcatgggcattcaacatctgactttattctttgaatcttatgatctcatgttcnnnnnnngggacagatcagtagaaaacaaccaaaaacctgtgtt |
300 |
Q |
| |
|
| || ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48485419 |
cttgtatgggcattcaacatctgactttattctttgaatcttatgatctcatgttctttttttgggacagatcagtagaaaacaaccaaaaacctgtgtt |
48485320 |
T |
|
| Q |
301 |
acctgaaaatcta |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48485319 |
acctgaaaatcta |
48485307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 69 - 113
Target Start/End: Original strand, 10035271 - 10035315
Alignment:
| Q |
69 |
tgcaggatctggaaaatatagattactattgcccagattgcaagg |
113 |
Q |
| |
|
|||||||||||||||||| || |||||||| ||||||||||||| |
|
|
| T |
10035271 |
tgcaggatctggaaaataccgactactattgtccagattgcaagg |
10035315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University