View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13155_low_7 (Length: 237)
Name: NF13155_low_7
Description: NF13155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13155_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 193111 - 193325
Alignment:
| Q |
1 |
tagacttctttgaatccatcaatgcaatatgattatattgtttctgttcttaccttatattttatgtagacagatttgagtgtgtggagtactatgattc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
193111 |
tagacttctttgaatccatcaatgcaatatggttatattgtttctgttcttaccttatattttatgtagacagatttgagtgtgtggagtactatgattc |
193210 |
T |
 |
| Q |
101 |
tcatgtgattgtgagtgatagcgtaatcatttataagctgaagttgcacaacttgctttttgaatacgtatttcctgccatgggaaatcctcgcattcgc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| | |
|
|
| T |
193211 |
tcatgtgattgtgagtgatagcgtaatcatttataagctgaagttgcacaacttgctttttgaatacgtatttcctgccatagggaatcctcgcattcac |
193310 |
T |
 |
| Q |
201 |
acgcagtcagcacat |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
193311 |
acgcagtcagcacat |
193325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University