View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13157_high_6 (Length: 375)
Name: NF13157_high_6
Description: NF13157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13157_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 305; Significance: 1e-171; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 305; E-Value: 1e-171
Query Start/End: Original strand, 12 - 358
Target Start/End: Complemental strand, 52396572 - 52396220
Alignment:
| Q |
12 |
attctcgtctaatcccatcaataaaaccagagttattcaatgacagtgcaaattccagctcttacacctacgacgacgtttcaaccgaaagaaaagaatc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52396572 |
attctcgtctaatcccatcaataaaaccagagttattcaatgacagtgcaaattccagctcttacacctacgacgacgtttcaaccgaaagaaaagaatc |
52396473 |
T |
 |
| Q |
112 |
agtacttaccgaagaagaagaag---gtgctacagcttctcacgcaattcatatcaaagaagaagttcttgaagaagacgacggtgcta---acgcttca |
205 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52396472 |
agtactaaccgaagaagaagaagaaggtgctacagcttctcacgcaattcatatcaaagaagaagttcttgaagaagacgacggtgctgctcacgcttca |
52396373 |
T |
 |
| Q |
206 |
tcttcactcaggtttccaaaaccaatggaagggctacatgaggttggtccaccaccgtttctcaagaaaacttttgaaatggtggatgatccggaaactg |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |||||||| |
|
|
| T |
52396372 |
tcttcactcaggtttccaaaaccaatggaagggctacatgaggttggtccaccaccgtttctcaagaagacttttgaaatggtggaggatctggaaactg |
52396273 |
T |
 |
| Q |
306 |
acccgattgtttcatggagtgcttctcgtgatagttttgttgtttgggattct |
358 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52396272 |
acccgattgtttcatggagtgcttctcgtgatagttttgttgtttgggattct |
52396220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University