View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13157_high_8 (Length: 367)
Name: NF13157_high_8
Description: NF13157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13157_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 2e-68; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 2e-68
Query Start/End: Original strand, 1 - 184
Target Start/End: Original strand, 52396562 - 52396760
Alignment:
| Q |
1 |
tagacgagaattgtagccaccgatttcaccgtcgtaaccaccgtgtgctaccgccattttatttctttgtttattgggttattcggcgttactctgtttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52396562 |
tagacgagaattgtagccaccgatttcaccgtcgtaaccaccgtgtgctaccgccattttatttctttgtttattgggttattcggcgttactctgtttt |
52396661 |
T |
|
| Q |
101 |
gccggt----tgagtgtgtttgtacttagcaatgaatgt-----------gaaagtgttgcacgttctatctggtatctatttatagatgataattgat |
184 |
Q |
| |
|
|||| | ||||||||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52396662 |
gccgcttgagtgagtgtgtctttacttagcaatgaatgtctttgggggaagaaagtgttgcacgttctatctggtatctatttatagatgataattgat |
52396760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 287 - 367
Target Start/End: Original strand, 52396927 - 52397007
Alignment:
| Q |
287 |
cgaagcaggtgagaacagtgtatatgtatctttgcaccggtccatttttggtaaaataagaccgatagccacgtttcatat |
367 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
52396927 |
cgaagcaggtgagaacagtgtatgtgtatctttgcaccggtccatttttggtaaaataagaccaatagccacgtttcatat |
52397007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University