View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13157_low_4 (Length: 394)
Name: NF13157_low_4
Description: NF13157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13157_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 4e-94; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 22 - 232
Target Start/End: Complemental strand, 46407335 - 46407124
Alignment:
| Q |
22 |
ttctatgtcccaaattatgcggtgaatgaaaagccacgtgcaattttgaacctacaactcgtgtctgctacctgccagtgattgattgctttactttttc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46407335 |
ttctatgtcccaaattatgcggtgaatgaaaagccacgtgcaattttaaacctacaactcgtgtctgctacctgccagtgattgattgctttactttttc |
46407236 |
T |
 |
| Q |
122 |
atatatctgaaatcagatatcacg-----atccttctgaccttagttagtagtaacgtttgaaagtgaaatttactgcctcccaacgctctttctctctc |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46407235 |
atatatctgaaatcagatatcacgatctcatccttctgaccttagttagtagtaacgtttgaaagtgaaatttactgcctcccaacgctctt----tctc |
46407140 |
T |
 |
| Q |
217 |
gcaccccccaaaatca |
232 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
46407139 |
gcaccccccaaaatca |
46407124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 260 - 378
Target Start/End: Complemental strand, 46407096 - 46406975
Alignment:
| Q |
260 |
ctctctgaaactcaggagtggacgtaagcttctaaaattcagtgttctacttactctcaaacnnnnnnnttgactcaaatggctgttt---ttatttttg |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
46407096 |
ctctctgaaactcaggagtggacgtaagcttctaaaattcagtgttctacttactctcaaacaaaaaaattgactcaaatggctgtttttattatttttg |
46406997 |
T |
 |
| Q |
357 |
ttcatcagctacaagaattttc |
378 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46406996 |
ttcatcagctacaagaattttc |
46406975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University