View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13158_high_5 (Length: 290)
Name: NF13158_high_5
Description: NF13158
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13158_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 7 - 273
Target Start/End: Complemental strand, 42780873 - 42780604
Alignment:
| Q |
7 |
ggatcaggaaaatcaatatgaacggtcatccattgagtatcctcaccctgaaatcaaagcacacaacaacgagtcaa-ctnnnnnnn--caacgaaagtc |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
42780873 |
ggatcaggaaaatcaatatgaacggtcatccattgagtatcctcaccctgaaatcaaagcacacaacaacgagtcaaactaaaaaaaaacaacgaaagtc |
42780774 |
T |
|
| Q |
104 |
aacagttgaaaattttaccaagttcaagtaaggatgttatgttattgttaccttaacgccgaggatagaaggagtggctataactgaagcattactgtga |
203 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
42780773 |
aacagttgaaaatgttaccaagttcaagtaaggatgttatgttattgttaccttaacgccgaggatagaaggagtggctgtaagtgaagcattactgtga |
42780674 |
T |
|
| Q |
204 |
agtgacacaatggttttgtgaatggcgattttggagagtggttgttcaccaaatccattagcatgagcag |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42780673 |
agtgacacaatggttttgtgaatggcgattttggagagtggttgttcaccaaatccattagcatgagcag |
42780604 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University