View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1315_low_8 (Length: 305)
Name: NF1315_low_8
Description: NF1315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1315_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 53248993 - 53248703
Alignment:
| Q |
1 |
ccacttttttatgctttctcatccgcctcttcttagcactggtaagttttactaggctaaattgatttaaaattaaatgttaaatgctgaannnnnnncc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
53248993 |
ccacttttttatgctttctcatccgcctcttcttagcactggtaagttttaccaggct-aattgatttaaaattaaatgttaaatgctgaatttttttcc |
53248895 |
T |
 |
| Q |
101 |
ataaaagagaaaggaaagaaatatatgatatactgatatagtcgac-ttcnnnnnnnnnnnnnnatctttctgttaatgtacacactactgattattttg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
53248894 |
ataaaagagaaaggaaagaaatatatgatatactgatatagtcgactttctttttcgtttttttatctttctgttaatgtacacactactgattattttg |
53248795 |
T |
 |
| Q |
200 |
cattgaggtggcctgtaaaattgtagttgccccctccnnnnnnnnngctcaaccaagtgagctacccatcccccctcccaaaattgttgctc |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
53248794 |
cattgaggtggcctgtaaaattgtagttgcctcctcctttttttttgctcaaccaagtgagctacccatcccccctcccaaaatagttgctc |
53248703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University