View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1315_low_9 (Length: 262)
Name: NF1315_low_9
Description: NF1315
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1315_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 30 - 152
Target Start/End: Complemental strand, 13017456 - 13017335
Alignment:
| Q |
30 |
gtatcaaaataatcaatgtatataattggttttgactctgtatctcttatcctacaaaattcaaaattaacactgaataacttgtattaactggcttggg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13017456 |
gtatcaaaataatcaatgtatataattggttttgact-tgtatctcttatcctacaaaattcaaaattaacactgaataactggtattaactggcttggg |
13017358 |
T |
|
| Q |
130 |
accttgaatatgctccttttcaa |
152 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
13017357 |
accttgaatatgctccttttcaa |
13017335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 174 - 258
Target Start/End: Complemental strand, 13017337 - 13017253
Alignment:
| Q |
174 |
caatgctaattttcctcaagttcgattttcctataatctctatatcagtcaagttaacacaattgctcatactttacgtgtagtt |
258 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13017337 |
caatgctaattttcctcaagatcgattttcctataatctccatatcagtcaagttaacacaattggtcatactttacgtgtagtt |
13017253 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University