View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13160_low_7 (Length: 273)
Name: NF13160_low_7
Description: NF13160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13160_low_7 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 8 - 273
Target Start/End: Original strand, 29911614 - 29911879
Alignment:
| Q |
8 |
ccaagaatatcaagaacaagaccacgacaccgtcgcatcccgcggcacagcggctgaacagaaccaagccaaccggaagctgaaagcgcatgacgagaaa |
107 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29911614 |
ccaacaataccaagaacaagaccacgacaccgtcgcatcccgcggcacagcggctgaacagaaccaagccaaccggaagctgaaagcgcatgacgagaaa |
29911713 |
T |
 |
| Q |
108 |
gcagatgagtccgacgaagaagaccgagaaacaacgccatcacagtatcagcgatctcttcagcacgtgaggtatcaacatgaacgagacggagaccaag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29911714 |
gcagatgagtccgacgaagaagaccgagaaacaacgccatcacagtatcagcgatctcttcagcacgtgaggtatcaacatgaacgagacggagaccaag |
29911813 |
T |
 |
| Q |
208 |
gtcagcagcgagggaggaatccacggcgcggtcagcagagccaaggcagaggatgaggtgatagga |
273 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29911814 |
gtcagcagcgagggaggaatccacggcgcggtcagcagagccaaggcagaggatgaggtgatagga |
29911879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University