View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13160_low_9 (Length: 229)
Name: NF13160_low_9
Description: NF13160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13160_low_9 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 19 - 209
Target Start/End: Complemental strand, 5324892 - 5324702
Alignment:
| Q |
19 |
caaagggcatacaaatatgggggatgaacaagctaggggcatattgcctaagagtggtcgggttgggcatataacccagagaagaagcacatagggaggt |
118 |
Q |
| |
|
|||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
5324892 |
caaagggcatacaaatctgggggatgaacatgctaggggcatattgcctaagagtggttgggttgggcatacaacccagagaagaagcacatagggaggt |
5324793 |
T |
 |
| Q |
119 |
tggccaatcccaatgtgacgtctcacctggttggcacaaccctctcatgtctaatgattgctatgttatgttggataaaatatttcttggg |
209 |
Q |
| |
|
|| |||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
5324792 |
tgaccaatcataatgtgacgtctcacctggttggcacaatcctctcatgtctaatgattgctatgttatgttggataaaatattttttggg |
5324702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University