View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13162_high_10 (Length: 310)
Name: NF13162_high_10
Description: NF13162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13162_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 7 - 293
Target Start/End: Complemental strand, 42003350 - 42003064
Alignment:
| Q |
7 |
gtagcaaagggaggatcagacatcatagccacaatcgaataattcatgttcttatcgttgttgatactactaatagagcttaaattcaaacaacttatag |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003350 |
gtagcaaaaggaggatcagacatcatagccacaatcgaataattcatgttcttatcgttgttgatactactaatagagcttaaattcaaacaacttatag |
42003251 |
T |
|
| Q |
107 |
gtggtactaaatttattacggttgaattggaaggacaatttaggaatgaaaaattaacaaaagtgtaataatcacttaaccgaaacggtgaatctttaag |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003250 |
gtggtactaaatttattacggttgaattggaaggacaatttaggaatgaaaaattaacaaaagtgtaataatcacttaaccgaaacggtgaatctttaag |
42003151 |
T |
|
| Q |
207 |
gtttaacatgaagttgttttggtcaaacatgaaacgttttgggaagcacatgttgggatcgttgacccaaactacttgatcaacaaa |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42003150 |
gtttaacatgaagttgttttggtcaaacatgaaacgttttgggaagcaaatgttgggatcgttgacccaaactacttgatcaacaaa |
42003064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University