View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13162_high_13 (Length: 262)
Name: NF13162_high_13
Description: NF13162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13162_high_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 45944990 - 45945231
Alignment:
| Q |
1 |
ctagttataagtacataagagaatttggttggaatgaaactttggccaggagttcatacgagtgggttgaaaagaaggttgtttttgagccttcaatgct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45944990 |
ctagttataagtacataagagaatttggttggaatgaaactttggccaggagttcatacgagtgggttgaaaagaaggttgtttttgagccttcaatgct |
45945089 |
T |
 |
| Q |
101 |
tcaatggcaatcagcagttagggacggtttacttgaagcagggattttgccttacaacggttttacatttgatcatgtatatgggactaaggttggaggg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45945090 |
tcaatggcaatcagcagttagggacggtttacttgaagcagggattttgccttacaacggttttacatttgatcatgtatatgggactaaggttggaggg |
45945189 |
T |
 |
| Q |
201 |
acaacttttgataaggaaggttataaacacactgcagctgat |
242 |
Q |
| |
|
|||| ||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
45945190 |
acaattttcgataaggaaggtcataaacacactgcagctgat |
45945231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 12 - 242
Target Start/End: Original strand, 45938237 - 45938467
Alignment:
| Q |
12 |
tacataagagaatttggttggaatgaaactttggccaggagttcatacgagtgggttgaaaagaaggttgtttttgagccttcaatgcttcaatggcaat |
111 |
Q |
| |
|
||||||||||| | ||||||||||||||||||||| | || |||||| || ||| ||||||||||||||| |||||||||| |||| | |||||| ||| |
|
|
| T |
45938237 |
tacataagagattctggttggaatgaaactttggctaagatttcatatgaatggattgaaaagaaggttgcttttgagcctcaaatgatgcaatggtaat |
45938336 |
T |
 |
| Q |
112 |
cagcagttagggacggtttacttgaagcagggattttgccttacaacggttttacatttgatcatgtatatgggactaaggttggagggacaacttttga |
211 |
Q |
| |
|
||||||| ||||| ||||||| |||||||||| |||| |||||||| |||||| | |||||||| | ||||||||||||||||| ||||||| |||||| |
|
|
| T |
45938337 |
cagcagtgagggatggtttacctgaagcaggggttttaccttacaatggttttgcttttgatcacttgtatgggactaaggttggtgggacaatttttga |
45938436 |
T |
 |
| Q |
212 |
taaggaaggttataaacacactgcagctgat |
242 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |
|
|
| T |
45938437 |
taaggaaggttatagacacactgcagctgat |
45938467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 83 - 242
Target Start/End: Original strand, 3091863 - 3092022
Alignment:
| Q |
83 |
ttttgagccttcaatgcttcaatggcaatcagcagttagggacggtttacttgaagcagggattttgccttacaacggttttacatttgatcatgtatat |
182 |
Q |
| |
|
|||| ||||| | |||| ||||||||||||||||||||| || || ||| | |||| ||| | ||||||||||| || ||||| | ||||||| | || |
|
|
| T |
3091863 |
ttttcagcctcctatgcgtcaatggcaatcagcagttagagatggattattggaagtaggtgtgttgccttacaatggctttacttatgatcatattcat |
3091962 |
T |
 |
| Q |
183 |
gggactaaggttggagggacaacttttgataaggaaggttataaacacactgcagctgat |
242 |
Q |
| |
|
||||||||||||||||| |||| ||||| | | ||| ||| |||||||||||||||| |
|
|
| T |
3091963 |
gggactaaggttggaggtacaatctttgaccataatggtcatagacacactgcagctgat |
3092022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 204
Target Start/End: Original strand, 3083436 - 3083544
Alignment:
| Q |
96 |
atgcttcaatggcaatcagcagttagggacggtttacttgaagcagggattttgccttacaacggttttacatttgatcatgtatatgggactaaggttg |
195 |
Q |
| |
|
|||| ||||||||||||||||||||| || || ||| | |||| ||| | ||||||||||| || ||||| | |||||| | ||||||||||||||| |
|
|
| T |
3083436 |
atgcgtcaatggcaatcagcagttagagatggattattggaagtaggtgtgttgccttacaatggctttacttatgatcacattcatgggactaaggttg |
3083535 |
T |
 |
| Q |
196 |
gagggacaa |
204 |
Q |
| |
|
|||| |||| |
|
|
| T |
3083536 |
gaggtacaa |
3083544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University