View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13162_high_8 (Length: 332)
Name: NF13162_high_8
Description: NF13162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13162_high_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 290; Significance: 1e-163; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 290; E-Value: 1e-163
Query Start/End: Original strand, 12 - 321
Target Start/End: Complemental strand, 27222794 - 27222485
Alignment:
| Q |
12 |
ttatgttaacttttattgttagtgattatgatgtggcacgctaactgaatatgcatttcctacttcctacactacacgttgatctcacatcaaagactaa |
111 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27222794 |
ttatgttaacttttatcgttagggattatgatgtggcacgctaactgaatatgcatttcctacttcctacactacacgttgatctcacatcaaagactaa |
27222695 |
T |
 |
| Q |
112 |
tttgcctatggaatttaggtcatatcaaggacaaatgtgtcaataattacaattgtgaggggactaaatactcgaaaattagcctttgatgtgaaggtat |
211 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27222694 |
tttgcctatggattttaggtcatatcaaggacaaatgtgtcagtaattacaattgtgaggggactaaatactcgaaaattagcctttgatgtgaaggtat |
27222595 |
T |
 |
| Q |
212 |
tgatgtgggataacgattcaacctagagcgaccatgtattcggttaatgtgccatataaaaatccctgatgtgagggctatatcctatactccccttttc |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27222594 |
tgatgtgggataacgattcaacctagagcgaccatgtattcggttaatgtgccatataaaaatccctgacgtgagggctatatcctatactccccttttc |
27222495 |
T |
 |
| Q |
312 |
tttcctcttc |
321 |
Q |
| |
|
|||||||||| |
|
|
| T |
27222494 |
tttcctcttc |
27222485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 107 - 169
Target Start/End: Original strand, 25893862 - 25893924
Alignment:
| Q |
107 |
actaatttgcctatggaatttaggtcatatcaaggacaaatgtgtcaataattacaattgtga |
169 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||| | ||||||||| ||||||||| |
|
|
| T |
25893862 |
actaatttgcctatgaaatttaggtcatctcaaggacaaatttttcaataattgcaattgtga |
25893924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 106 - 156
Target Start/End: Original strand, 2505572 - 2505622
Alignment:
| Q |
106 |
gactaatttgcctatggaatttaggtcatatcaaggacaaatgtgtcaata |
156 |
Q |
| |
|
|||||||||||||||| ||||| |||||| |||| ||||||| |||||||| |
|
|
| T |
2505572 |
gactaatttgcctatgaaatttgggtcatctcaacgacaaatttgtcaata |
2505622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 106 - 139
Target Start/End: Original strand, 31135053 - 31135086
Alignment:
| Q |
106 |
gactaatttgcctatggaatttaggtcatatcaa |
139 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |
|
|
| T |
31135053 |
gactaatttgcctatgaaatttaggtcatatcaa |
31135086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University