View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13162_low_14 (Length: 240)
Name: NF13162_low_14
Description: NF13162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13162_low_14 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 9 - 227
Target Start/End: Original strand, 27222880 - 27223098
Alignment:
| Q |
9 |
tttgatgactaattgaccagtagaatctaaatttagcgtagtttatagacacgtacacatgacatctatccaacaaacgatcaaatcattacaaattcac |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27222880 |
tttgatgactaattgaccagtagaatctaaatttagcgtagtttatagacacgtacacatgacatctatccaacaaacgatcaaatcattacaaattcac |
27222979 |
T |
|
| Q |
109 |
ttcaagaaggtactgatgaattatttatgcttctaccaaaagatgtactagctgttgtacattattggtttttgcatacctaaatttatttcccatcatg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27222980 |
ttcaagaaggtactgatgaattatttatgcttctaccaaaagatgtactagctgttgtacattattggtttttgcatacctaaatttatttcccatcatg |
27223079 |
T |
|
| Q |
209 |
ggttttctgggatgtattt |
227 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
27223080 |
ggttttctgggatgtattt |
27223098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University