View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13162_low_15 (Length: 238)
Name: NF13162_low_15
Description: NF13162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13162_low_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 32486275 - 32486493
Alignment:
| Q |
17 |
agattttccaatattttttatctctcagttaggatattgccaaaataaaatttgattttgacaaaggttgtcttttggacaaacaatattctcaacaaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32486275 |
agattttccaatattttttatctctcagttaggatattgccaaaataaaatttgattttgacaaaggttgtcttttggacaaacaatattctcaacaaac |
32486374 |
T |
 |
| Q |
117 |
aaaatctctgttacgaatacaagccaaaataataaattatgacagattgtattacagatcgtaccttcnnnnnnnggaaaaattattaggttccaacttg |
216 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32486375 |
aaaatctctgttacgaatacaagccaa---aataaattatgacagattgtattacagatcgtaccttctttttttggaaaaattattaggttccaacttg |
32486471 |
T |
 |
| Q |
217 |
tatgtaagttattggtacgtac |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32486472 |
tatgtaagttattggtacgtac |
32486493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University