View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13162_low_9 (Length: 311)
Name: NF13162_low_9
Description: NF13162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13162_low_9 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 20 - 298
Target Start/End: Original strand, 38469610 - 38469887
Alignment:
| Q |
20 |
ggaactggaaa-tcgatcaaggttggtagaaggggtcctgaagtctcgcacttaatgtttgcagatgatttattgttatttagaaaagctacgaagattc |
118 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
38469610 |
ggaactggaaaatcgatcaaggttggtagaaggggtcctgaagtctcgcacttaatgtttgcagatgatttattgttatttagagaagctacgaagattc |
38469709 |
T |
|
| Q |
119 |
aaaagtggtgtgtgactcataacttgtaccaggttagtatgctatctggtcaaaaagttagcaatgagaagaccaatatgttcttttctaagaatgtgtc |
218 |
Q |
| |
|
||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38469710 |
aaatgtggtgtgtgactcataacttgcaccaggttagtatgctatctggtcaaaaagttagtaatgagaagaccaatatgttcttttctaagaatgtgtc |
38469809 |
T |
|
| Q |
219 |
aagaggaatgtgtgtgaggttttggtacatctttctggatttcgagaaactcactctcggaaaatatttgggagtgcttc |
298 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38469810 |
aagaggaa--tgcgtgaggttttggtacatctttctggatttcgagaaactcactctcgaaaaatatttgggagtgcttc |
38469887 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University