View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13163_low_10 (Length: 223)
Name: NF13163_low_10
Description: NF13163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13163_low_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 17 - 212
Target Start/End: Original strand, 39044249 - 39044444
Alignment:
| Q |
17 |
cacatttctcttctccaacggaaccctaacggtttcctcataaaccccttctttgatatatatgacaaatctcttcccgtcaacgccgttatccggcgca |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
39044249 |
cacatttctcttctccaacggaaccctaacggtttcctcataaaccccttctttgatatatatgacaaacctcttcctgtcaacgccgttatccggcgca |
39044348 |
T |
|
| Q |
117 |
gcattaacagcttcttgcaccgtcttataacaaccattcttccctcccttacacactgtaacatccggcgtcaacttcgccggaatccctatgcta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39044349 |
gcattaacagcttcttgcaccgtcttataacaacccttctcccctcccttacacactgtaacatccggcgtcaacttcgccggaatccctacgcta |
39044444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University