View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13163_low_5 (Length: 351)

Name: NF13163_low_5
Description: NF13163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13163_low_5
NF13163_low_5
[»] chr2 (2 HSPs)
chr2 (1-103)||(8923972-8924075)
chr2 (281-330)||(8924277-8924326)


Alignment Details
Target: chr2 (Bit Score: 71; Significance: 4e-32; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 8923972 - 8924075
Alignment:
1 tcaaagacaaagattatgacattatatttttt-acttcattatcctattataannnnnnnatgaccgaaagttttaagtgagttgcaaggccgcaaatag 99  Q
    |||||||||||||||||||||||||||||||| | ||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||    
8923972 tcaaagacaaagattatgacattatatttttttatttcattatcctattataatttttttatgaccgaaagttttaagtgagttgcaaggccgcaaatag 8924071  T
100 taag 103  Q
    ||||    
8924072 taag 8924075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 281 - 330
Target Start/End: Original strand, 8924277 - 8924326
Alignment:
281 ggtggtagccacctgtgactgtggagttgggtgattttgtgaagaagaaa 330  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
8924277 ggtggtagccacctgtgactgtggagttgggtgattttgtgaagaagaaa 8924326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University