View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13163_low_5 (Length: 351)
Name: NF13163_low_5
Description: NF13163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13163_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 71; Significance: 4e-32; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 8923972 - 8924075
Alignment:
| Q |
1 |
tcaaagacaaagattatgacattatatttttt-acttcattatcctattataannnnnnnatgaccgaaagttttaagtgagttgcaaggccgcaaatag |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8923972 |
tcaaagacaaagattatgacattatatttttttatttcattatcctattataatttttttatgaccgaaagttttaagtgagttgcaaggccgcaaatag |
8924071 |
T |
|
| Q |
100 |
taag |
103 |
Q |
| |
|
|||| |
|
|
| T |
8924072 |
taag |
8924075 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 281 - 330
Target Start/End: Original strand, 8924277 - 8924326
Alignment:
| Q |
281 |
ggtggtagccacctgtgactgtggagttgggtgattttgtgaagaagaaa |
330 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8924277 |
ggtggtagccacctgtgactgtggagttgggtgattttgtgaagaagaaa |
8924326 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University