View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13165_high_3 (Length: 216)
Name: NF13165_high_3
Description: NF13165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13165_high_3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 48 - 171
Target Start/End: Original strand, 1736639 - 1736762
Alignment:
| Q |
48 |
tgaagcatggaaattggtacaagaaataaaaaacgctcacttccaaccaaatttcctaaaatacctttatatgacttgtgacacaggtgttataccgagc |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||| | | |
|
|
| T |
1736639 |
tgaagcatggaaattggtacaagaaataaaaaacgttcacttccaaccaaatttcctaaaatacctttatacgacttgttacacaggtgttatacccaac |
1736738 |
T |
|
| Q |
148 |
gtaacttaaataacgttggaatac |
171 |
Q |
| |
|
|||| ||||||||||||||||||| |
|
|
| T |
1736739 |
gtaaattaaataacgttggaatac |
1736762 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 19 - 48
Target Start/End: Complemental strand, 1736923 - 1736894
Alignment:
| Q |
19 |
tgaataaatatgaaatccttaattagcctt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
1736923 |
tgaataaatatgaaatccttaattagcctt |
1736894 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University