View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13165_low_2 (Length: 386)
Name: NF13165_low_2
Description: NF13165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13165_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 13 - 368
Target Start/End: Complemental strand, 27888741 - 27888386
Alignment:
| Q |
13 |
aaaattatgtgggtagaaaagacgttcatgtgagcaaagaaggttggtttgaggaaagtttggcgcgtagaattggcaatgatgagatttcttccttttg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
27888741 |
aaaattatgtgggtagaaaagacgttcatgtgagcaaaggaggttggtttgaggaaagtttggcgcgtagaattggcaatgatgaaatttcttccttttg |
27888642 |
T |
 |
| Q |
113 |
aaacaatccttgtctagaagaaggaattttatatttagttttctttttagccattatcttaatagtaatatttcagtagatgagatggggagttaggttg |
212 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27888641 |
aaacaatccttgcccagaagaaggaattttatatttagttttctttttagccattatcttaatagtaatatttcagtagatgagatggggagttaggttg |
27888542 |
T |
 |
| Q |
213 |
ggggttgaggtttatacttgaaggtggagaaagaggctttttactttgaaagaggagcaagtagttgagtgttgctctttgttggacaatattcttttgc |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27888541 |
ggggttgaggtttatacttgaaggtggagaaagaggctttttactttgaaagaggagtaagtagttgagtgttgctctttgctggacaatattcttttgc |
27888442 |
T |
 |
| Q |
313 |
aggataatatagcgatcacatggatttggaaacacgatccacatgaaggttatcta |
368 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27888441 |
aggataatatagcgattacatggatttggaaacacgatccacatgaaggttatcta |
27888386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University