View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13167_low_6 (Length: 213)
Name: NF13167_low_6
Description: NF13167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13167_low_6 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 117; Significance: 9e-60; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 11 - 197
Target Start/End: Original strand, 25602395 - 25602589
Alignment:
| Q |
11 |
agaaaatatgtgagaaaagtcggtcttctattactatatccactcttaaggtacgttatgatgttttcattctttaatttcaccttcttaaaattcttta |
110 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25602395 |
agaaaatatgtgagaaaggtcggtcttctattactatatccactcttaaggtacgttatgatgttttcattctttaatttcaccttcttaaaattcttta |
25602494 |
T |
 |
| Q |
111 |
--------tttannnnnnngtaaattctgtttaaaatcaactgacttgcataaatgatcttattaactctcattccttaatgtgtaggtggttct |
197 |
Q |
| |
|
||| |||||||||||||||||||||||||||||| ||| ||||||||||||| || |||||||||||||||||| ||||| |
|
|
| T |
25602495 |
tatttattttttttgttttgtaaattctgtttaaaatcaactgacttgcctaactgatcttattaaccctaattccttaatgtgtaggttgttct |
25602589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 189
Target Start/End: Complemental strand, 55116639 - 55116573
Alignment:
| Q |
123 |
taaattctgtttaaaatcaactgacttgcataaatgatcttattaactctcattccttaatgtgtag |
189 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| ||||| |||| || ||||||||| | ||||||| |
|
|
| T |
55116639 |
taaatcctgtttaaaatcaattgacttgcatagttgatcctattcaccctcattcctcattgtgtag |
55116573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University