View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13169_high_14 (Length: 316)

Name: NF13169_high_14
Description: NF13169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13169_high_14
NF13169_high_14
[»] chr1 (1 HSPs)
chr1 (1-76)||(47435702-47435777)


Alignment Details
Target: chr1 (Bit Score: 76; Significance: 4e-35; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 1 - 76
Target Start/End: Complemental strand, 47435777 - 47435702
Alignment:
1 aaatgaagctgaatacgttagggttttccccaatggaataagtccgaaactcatggggttaaaatctgaatcttca 76  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47435777 aaatgaagctgaatacgttagggttttccccaatggaataagtccgaaactcatggggttaaaatctgaatcttca 47435702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University