View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13169_high_4 (Length: 462)
Name: NF13169_high_4
Description: NF13169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13169_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 367; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 367; E-Value: 0
Query Start/End: Original strand, 31 - 453
Target Start/End: Original strand, 2467765 - 2468178
Alignment:
| Q |
31 |
ctcacttatatcctcttccattttcccccctcctactcctcgctgcaatctcaaattaccaccacgctttcaattcaccaacatttttcgggctacaacg |
130 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
2467765 |
ctcacttatatcctcttccatttttccccctcctactcctcgctgcaatctcaaattaccaccacgctttcaattcaccaacatttttcggtctacaacg |
2467864 |
T |
|
| Q |
131 |
gtaatttcctgaacctatcttcaacttcatttcattcaattcaatgcctcaaatttattctcattttcgtatagggattcgttcgtgcttccgaggatga |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467865 |
gtaatttcctgaacctatcttcaacttcatttcattcaattcaatgcctcaaatttattttcattttcgtatagggattcgttcgtgcttccgaggatga |
2467964 |
T |
|
| Q |
231 |
ctctgttgccgaaaattccgattctcaatgccaattggcaacacagaatgtgtcttctgatgataatgatgatgcatccatgacagttttgaagtttatg |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2467965 |
ctctgttgccgaaaattccgattctcaatgccaattggcaacacagaatgtgtcttc---------tgatgatgcatccatgacagttttgaagtttatg |
2468055 |
T |
|
| Q |
331 |
ctgttctctgcgttcttcgcacttcaagatgcttttccggcagttgctgcttctgattttgctactggttcgaattcaattcctatatttggagatgtcg |
430 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2468056 |
ctgttctccgcgttcttcgcacttcaagatgcttttccggcagttgctgcttctgattttgctactggtttgaattcaattcctatatttggagatgtcg |
2468155 |
T |
|
| Q |
431 |
gtgacttaagcacaggttctgct |
453 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
2468156 |
gtgacttaagcacaggttttgct |
2468178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University