View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13169_low_2 (Length: 279)
Name: NF13169_low_2
Description: NF13169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13169_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 10 - 264
Target Start/End: Original strand, 27306100 - 27306351
Alignment:
| Q |
10 |
attattctacaaattcttgcttaatgtgagtcaaatgatgaggatagtttgcatttgtttttcaagtgtctaaatagttgcannnnnnnagcatgtgtac |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
27306100 |
attatcctacaaattcttgcttaatgtgagtcaaatgatgaggatagtttgcatttgtttttcaagtgtccaaatagttgcatttttttagcatgtgtac |
27306199 |
T |
|
| Q |
110 |
agcgtatgcaacgattagcaacattgtaaatcaactacatgatagctcagctataattttcaagattttgcaagtgttatcaaaggaagatacatcannn |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27306200 |
agcgtatgcaacgattagcaacattgtaaatcaactacatgatagctcagctataattttcaagattttgcaagtgttatcaaaggaagatacatca--- |
27306296 |
T |
|
| Q |
210 |
nnnnnnncttttgtcttgtggtgcgtatggaagaaaaagaatacaaaattggaat |
264 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
27306297 |
tttttttcttttgtcttgtagtgcgtatggaagaaaaagaatacaaaattggaat |
27306351 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University