View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1316_low_2 (Length: 267)
Name: NF1316_low_2
Description: NF1316
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1316_low_2 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 30 - 267
Target Start/End: Original strand, 49247162 - 49247411
Alignment:
| Q |
30 |
gttgttgttcctaatgagataacgaatgttaagcaagagaatgcattggagaagaacctggaaggtgc------tgtttctcagaataagacacaagaaa |
123 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49247162 |
gttgttgttcctaatgagataacgaattttaagcaagagaatgcattggagaagaacctggaaggtgaaggtgatgtttctcagaataagacacaagaaa |
49247261 |
T |
 |
| Q |
124 |
tcattgttgcagaggagaaaaatgattcattggaaaataaaaatcaacctgaacctgcagaagaagcaaaaatagtaacacaaaatgaaaaaggtgagaa |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
49247262 |
tcattgttgcagaggagaaaaatgattcattggaaaataaaaatcaacctgaacctgcagaagaagcaaaaatagtaacggaaaatcaaaaaggtgagaa |
49247361 |
T |
 |
| Q |
224 |
tgatgttgtagattttc------attaatttcaaataagattattaaata |
267 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
49247362 |
tgatgttgtagattttcattcttattaatttcaaataagattattaaata |
49247411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University