View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13170_low_12 (Length: 244)
Name: NF13170_low_12
Description: NF13170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13170_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 228
Target Start/End: Original strand, 46740947 - 46741174
Alignment:
| Q |
1 |
ctttgatggagaaaattttgaaaagcaatacaatcgtggctgaatggttgtcttatcccaaagacttcatacagaagttggtccagcaaagatatgcacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46740947 |
ctttgatggagaaaattttgaaaagcaatatcatcgtggctgcatggttgtcttatcccaaagacttcatacagaagttggtccagcaaagatatgcacg |
46741046 |
T |
|
| Q |
101 |
gttgcttgcccaaatatttctctcagacttctataggacgttactgcgaccagatacatggttctacgcattctatttttctttcttttgttgcatttac |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46741047 |
gttgcttgcctaaatatttctctcagacttctataggacgttactgcgaccagatacatggttctacgcattctatttttctttcttttgttacatttac |
46741146 |
T |
|
| Q |
201 |
ttctatacccttttagaagatattcatg |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
46741147 |
ttctatacccttttagaagatattcatg |
46741174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University