View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13170_low_13 (Length: 243)
Name: NF13170_low_13
Description: NF13170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13170_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 17 - 165
Target Start/End: Original strand, 39158640 - 39158785
Alignment:
| Q |
17 |
taatgataaccaaacacgcaattttagtcaaaatacttactacatcctaatacatggggcggttctgtaattataattaaaaagcaagggtgtaattaaa |
116 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39158640 |
taatgataaccaaacacacaattttagtcaaaatacttac---atcctaatacatggggcggttctgtaattataattaaaaagcaagggtgtaattaaa |
39158736 |
T |
 |
| Q |
117 |
atttcaacttaaaaaagaggggcattttcgacagaccttcttgctgaag |
165 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39158737 |
atttcaacttaaaaaagaagggcattttcgacagaccttcttgctgaag |
39158785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University