View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13171_low_4 (Length: 382)
Name: NF13171_low_4
Description: NF13171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13171_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 361; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 361; E-Value: 0
Query Start/End: Original strand, 1 - 381
Target Start/End: Original strand, 44704154 - 44704534
Alignment:
| Q |
1 |
atgaccaacatgttgattatgatctctactgtcatcatctgcattggttgtatggctatcaatttcttctgctcttttaacatcatggattccagctttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44704154 |
atgaccaacatgttgattatgatctctactgtcatcatctgcattggttgtatggctatcaatttcttctgctcttttaacatcatggattccagctttc |
44704253 |
T |
|
| Q |
101 |
tcagtgtcgctttctttattattctcttgtacaattcgcttggggggagtcacgtaaaggattcccccatcgaattttccggctatgttatcaatctcag |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44704254 |
tcagtgtcgctttctttattattctcttgtacaattcgcttggggagagtcacgtaaaggattcccccatcgaattttccggctatgttatcaatctcag |
44704353 |
T |
|
| Q |
201 |
aatcagttggttctggaaaactcaggtgaaaacgaacacgtttctgctcacttgcttgcctttctcccttgacaacaatacggccactgctatcaacctg |
300 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44704354 |
aatcatttggttctggaaaactcaggtgaaaacgaacacgtttctgctcacttgcttgcctttctcccttgacaacaatacggccactgctatcaacctg |
44704453 |
T |
|
| Q |
301 |
aagcttcacatcttccttcacaaattctgtacagaaacaatttgaaagagaagacaaaaatattcacaggttctgctcgtt |
381 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |||||| |
|
|
| T |
44704454 |
aagcttcacatcttccttcacaaattctgtacagaaacaatttgaaagagaagacaaaaatattcacaagttattctcgtt |
44704534 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University