View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13172_high_22 (Length: 250)
Name: NF13172_high_22
Description: NF13172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13172_high_22 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 12 - 250
Target Start/End: Complemental strand, 10281827 - 10281589
Alignment:
| Q |
12 |
atgaatggagacaggaacactcctctgatgcaaaatgacaaaagagtaacaattctaggagttcaatgtgtttctcataggacatgataaacgcatgtgc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10281827 |
atgaatggagacaggaacactcctctgatgcaaaatgacaaaagagtaacaattctaggagttcaatgtgtttctcataggacatgataaacgcatgtgc |
10281728 |
T |
|
| Q |
112 |
tattttgtttaattaaattgtttctccaaacatgatcttaatatctaatgacactgccttttagaatgctctctaataacgctcaagaaatagaaagcaa |
211 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10281727 |
tattttgtttaattaaattgtttatccaaacatgatcttaatatctaatgacactgccttttagaatgctctctaataacgctcaagaaatagaaagcaa |
10281628 |
T |
|
| Q |
212 |
gctcaatttactgagcttgaatcagcctttggggcatat |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10281627 |
gctcaatttactgagcttgaatcagcctttggggcatat |
10281589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 103
Target Start/End: Original strand, 47544169 - 47544209
Alignment:
| Q |
63 |
attctaggagttcaatgtgtttctcataggacatgataaac |
103 |
Q |
| |
|
|||||||||||||||| |||||| |||| |||||||||||| |
|
|
| T |
47544169 |
attctaggagttcaatatgtttcacatacgacatgataaac |
47544209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University