View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13172_low_19 (Length: 263)
Name: NF13172_low_19
Description: NF13172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13172_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 42 - 245
Target Start/End: Complemental strand, 53683026 - 53682824
Alignment:
| Q |
42 |
tcattaggacattaatttggtgatgtagacacgacattgacatcgatagtaattttagaaaatggaatcggtgaatgtaaccactgaacacatatcggac |
141 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
53683026 |
tcattagaacattaatttggtgatgtagacacgacattgacatcgatagtaattttagaaaatggaatcggtgaacgtaaccactga-cacatatcggac |
53682928 |
T |
|
| Q |
142 |
acggaacatgtctttaatatgaagtgacaaagtccttgtctttgccattaactctcttttcattggaaattacagatagcagtgaagaaactgaaagcaa |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53682927 |
acggaacatgtctttaatatgaagtgacaaagtccttgtctttgccattaactctcttttcattggaaattacagatagcagtgaagaaactgaaagcaa |
53682828 |
T |
|
| Q |
242 |
tgaa |
245 |
Q |
| |
|
|||| |
|
|
| T |
53682827 |
tgaa |
53682824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University