View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13172_low_23 (Length: 240)
Name: NF13172_low_23
Description: NF13172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13172_low_23 |
 | |
|
| [»] scaffold0117 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 10281152 - 10280931
Alignment:
| Q |
1 |
acactcactactagcttgattatagaaatacatcaacctgagggataacttgttagcttgaaacaatgatagaccgttatatgtacttctctagttgaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10281152 |
acactcactactagcttgattatagaaatacatcaacctgagggataacttgttagcttgaaacaatgatagaccgttatatgtacttctctagttgaat |
10281053 |
T |
|
| Q |
101 |
atcatctatgatgaaaaaacacaaattaaataacttaaaaggtttcagacaaagttattacatcaactagacacaatacgatctcaagttcaggctttat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10281052 |
atcatctatgatgaaaaaacacaaattaaataacttaaaaggtttcagacaaagttattacatcaactagacacaatacgatctcaagttcaggctttat |
10280953 |
T |
|
| Q |
201 |
ggaaggaatggctagatctgtt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
10280952 |
ggaaggaatggctagatctgtt |
10280931 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 77 - 170
Target Start/End: Complemental strand, 10266512 - 10266419
Alignment:
| Q |
77 |
ttatatgtacttctctagttgaatatcatctatgatgaaaaaacacaaattaaataacttaaaaggtttcagacaaagttattacatcaactag |
170 |
Q |
| |
|
|||| ||| |||||||||||||||||||| |||||||||||| || ||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
10266512 |
ttatttgtgcttctctagttgaatatcatttatgatgaaaaaccataaattaaataacttataaggtttcagacaaagttattacatgaactag |
10266419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 10 - 54
Target Start/End: Complemental strand, 13411 - 13367
Alignment:
| Q |
10 |
actagcttgattatagaaatacatcaacctgagggataacttgtt |
54 |
Q |
| |
|
|||| |||||||||||||| || ||| |||||||||||||||||| |
|
|
| T |
13411 |
actaacttgattatagaaacacttcagcctgagggataacttgtt |
13367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University