View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13173_high_33 (Length: 263)
Name: NF13173_high_33
Description: NF13173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13173_high_33 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 11 - 263
Target Start/End: Original strand, 1409889 - 1410140
Alignment:
| Q |
11 |
cataggtgtttgaaaaatgtgtcgtgccacattgttatcgaccaatcatttactatcatcagatttcattgttttgtgtttggcatgagcatgtccgcag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1409889 |
cataggtgtttgaaaaatgtgtcgtgccacattgttatcgaccaatcatttactatcaccagatttcattgttttgtgtttggcatgagcatgtccgcag |
1409988 |
T |
|
| Q |
111 |
tgaaatgatgttaaacaacatgcagttgtgtcgtcgggatagttacttcgtcaatgtttaactaattattgtgattccatattggtatcctatcccaagt |
210 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1409989 |
tgaaatgatgttaa-caacatttagttgtgtcgtcgggatagttacttcgtcaatgtttaactaattattgtgattccatattggtatcctatcccaagt |
1410087 |
T |
|
| Q |
211 |
tacaatgctccactgaaaaccgcgacgaatcacctgcttcgcactccaaatcc |
263 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
1410088 |
tacaatgctccattgaaaaccgcgacaaatcacctgcttcgcactccaaatcc |
1410140 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University