View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13173_high_36 (Length: 250)
Name: NF13173_high_36
Description: NF13173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13173_high_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 8932649 - 8932414
Alignment:
| Q |
1 |
gggggaatatgttgtttgaaagatctcaagtggaatttaaactgggaatgagtgattggaagaaaaagttggatgcttctgtcgaacggttcaagattgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8932649 |
gggggaatatgttgtttgaaagatctcaagtggaatttaaactgggaatgagtgattggaagaaaaagttggatgcttctgtcgaacggttcaagattgc |
8932550 |
T |
|
| Q |
101 |
tggggcttctgaggctgatgtttcggggattttgaagaagcattgtttcaatggaaatacaagggatgaaaaaataaagggatcaccaagaacacacaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
8932549 |
tggggcttctgaggctgatgtttcggggattttgaagaagcattgtttcaatggaaatgcaagggatgaaaaaataaagggatcaccgagaacacacaat |
8932450 |
T |
|
| Q |
201 |
gtaatcaaaacgatgaaatagataacaatgaatgtg |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
8932449 |
gtaatcaaaacgatgaaatagataacaatgaatgtg |
8932414 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University