View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13173_high_41 (Length: 238)
Name: NF13173_high_41
Description: NF13173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13173_high_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 15 - 219
Target Start/End: Original strand, 48215329 - 48215541
Alignment:
| Q |
15 |
aatatgttgggaacattcatgcaatatatggggacaattcc--------ttcaatgaagtaaaaaattctaaacgaggttgtgaaccgtgcttaagacca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48215329 |
aatatgttgggaacattcatgcaatatatgaggacaattccaaagtaccttcaatgaagtaaagaattctaaacgaggttgtgaaccgtgtttaagacca |
48215428 |
T |
 |
| Q |
107 |
tatatctcaatttgccattcagagattcgaatgaattcacctcgtgcaaactgtttcttcaagccattcaatactatgtgcaatagaaggttcaacataa |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48215429 |
tatatctcaatttgccattcagagattcgaatgaattcacctcgtgcaaattgtttcttcaagccattcaatactatgtgcaatagaaggttcaacataa |
48215528 |
T |
 |
| Q |
207 |
atcatgatccatg |
219 |
Q |
| |
|
||||||||||||| |
|
|
| T |
48215529 |
atcatgatccatg |
48215541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University