View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13173_high_45 (Length: 216)
Name: NF13173_high_45
Description: NF13173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13173_high_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 14 - 191
Target Start/End: Complemental strand, 274070 - 273897
Alignment:
| Q |
14 |
aagaatatagaaggggaaggaggatgattgatcggtgtaggatatttaaaagggggtgggaatgaaaaaagagggatggggatagtaatgagaaacacac |
113 |
Q |
| |
|
||||| ||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
274070 |
aagaaaatagaaggg-aaggaggatgattgatcggtgtaggatatttaaaaaggggtgggaatgaaaaaagagggatggggatagtaatgagaaacacac |
273972 |
T |
|
| Q |
114 |
gtaaacgggccgggtcgggcgataatcactgagtggctgctaagtctggttgattttgaaattgaaatctatcaaaaa |
191 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
273971 |
gtaaacgggccgggtcgggcgataataactcagtggctg---agtctggttgattttgaaattgaaatctatcaaaaa |
273897 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University