View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13173_low_18 (Length: 464)
Name: NF13173_low_18
Description: NF13173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13173_low_18 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-165; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-165
Query Start/End: Original strand, 37 - 464
Target Start/End: Complemental strand, 1410626 - 1410201
Alignment:
| Q |
37 |
tttaaaacgggtcccacatctcagtaaatatattaatattttatttgctttttattgcactccttcgtcttttcacatttttgctgtagaaaaacattga |
136 |
Q |
| |
|
||||||||||||||||||||| | ||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
1410626 |
tttaaaacgggtcccacatctaaccaaacatattaatattttatttgctttttattgcactctttcgtcttttcacatttttgctgtagaaaaacgttga |
1410527 |
T |
 |
| Q |
137 |
gaatgtgcaggatgagttgcttcagtagagcacggtgattacaagtcgtcgaacttcaataannnnnnnggcgaaatactccccttttgtaattacgttg |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||| ||| |||||||||||||||| |||||||||| |
|
|
| T |
1410526 |
gaatgtgcaggatgagttgcttcagtagagcacggtgattataagtcgtc--actttaataatttttttggcaaaatactccccttttgaaattacgttg |
1410429 |
T |
 |
| Q |
237 |
tggcgtatctagtcaatgaaattgctcttagtagcggagagtattagatatgatatgcacttttgatctaaaatatattannnnnnnatttgttaggata |
336 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||| ||| ||||||||||||| | ||||||||||||||||||||||| ||||| |||| | |
|
|
| T |
1410428 |
tggcgtatatagtcaatgaagttgctcttagtagcgaagaatattagatatgatgtacacttttgatctaaaatatattatttttttatttgccaggaaa |
1410329 |
T |
 |
| Q |
337 |
cgaaatgacaaatataaacataatgtttcatattcaaatgatacgaccctaaacctatcatcaaactcaagtgaaagtgttcagtttaggcttacgagtg |
436 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1410328 |
cgaaatgacaaatataaacacaatgtttcatattcaaatgatacgaccctaaacctatcatcaaactcaagtgaaagtgttcagtttaggcttacgagtg |
1410229 |
T |
 |
| Q |
437 |
gattgcattcttttagatggctacgatt |
464 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
1410228 |
gattgcattcttttagatggctacgatt |
1410201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University