View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13173_low_22 (Length: 397)
Name: NF13173_low_22
Description: NF13173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13173_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 334; Significance: 0; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 21 - 386
Target Start/End: Original strand, 42473541 - 42473906
Alignment:
| Q |
21 |
agtcttggaattgttcttgtctcgtttggatgttggggataatattcgtgcttcagctgtttgcaagagatggtgttcagttgccacttctgtacgtgta |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42473541 |
agtcttggaattgttcttgtctcgtttggatgttggggataatatccgtgcttcagctgtttgcaagagatggtgttcagttgccacttctgtacgtgta |
42473640 |
T |
|
| Q |
121 |
ctcgaccaatcaccttggcttatgtatttcccaaaaattggtaattgttatgatttttatgaccctatgcagcgtaagactattcccttgagttgccaga |
220 |
Q |
| |
|
| |||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42473641 |
gtggaccaatcacctcggcttatgtatttcccaaaaattggtaatttttatgatttttatgaccctatgcagcgtaagactattcccttgagttgccaga |
42473740 |
T |
|
| Q |
221 |
gttggatggatgtcgtgtttgctatgcaaaagatggttggttattgctaaaccggcatgactggcggagtttggacagagattgcattttttctctcttt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
42473741 |
gttggatggatgtcgtgtttgctatgcaaaagatggttggttattgctaaaccggcatgactagcggaggttggacagagatcgcattttttctctcttt |
42473840 |
T |
|
| Q |
321 |
aatccctttactagggatctgatcacgctgccaagctttaaaaggacataccgaaatgctgccttt |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42473841 |
aatccctttactagggatctgatcacgctgccaagctttaaaaggacataccgaaatgctgccttt |
42473906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 21 - 385
Target Start/End: Original strand, 42479078 - 42479443
Alignment:
| Q |
21 |
agtcttggaattgttcttgtctcgtttggatgttggggataatattcgtgcttcagctgtttgcaagagatggtgttcagttgccacttctgtacgtgta |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42479078 |
agtcttggaattgttcttgtctcgtttggatattggggataatattcgtgcttcagctgtttgcaagagatggtgttcagttgccacttctgtacgtgta |
42479177 |
T |
|
| Q |
121 |
ctcgaccaatcaccttggcttatgtatttcccaaaaattggtaattgttatgatttttatgaccctatgcagcgtaaga-ctattcccttgagttgccag |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| | |||||||||| |||||||||||||||||||| |
|
|
| T |
42479178 |
ctcgaccaatcaccttggcttatgtatttcccaaaaaagggtaattgttatgatttctatgaccctgttcagcgtaagacctattcccttgagttgccag |
42479277 |
T |
|
| Q |
220 |
agttggatggatgtcgtgtttgctatgcaaaagatggttggttattgctaaaccggcatgactggcggagtttggacagagattgcattttttctctctt |
319 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||| |||||| || || |||||| |||||||| |
|
|
| T |
42479278 |
agttggatggatgtcgtgtttgctatacaaaagatggttggttattgctaaaccggcaggactggcggaggttggacggaaatcacattttctctctctt |
42479377 |
T |
|
| Q |
320 |
taatccctttactagggatctgatcacgctgccaagctttaaaaggacataccgaaatgctgcctt |
385 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||| | |||||||| | || ||||||||| |
|
|
| T |
42479378 |
taatccctttactagggatctgatcacgctgccaaaatttgacaggacatatcaaattgctgcctt |
42479443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 6e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 57 - 276
Target Start/End: Complemental strand, 26047365 - 26047145
Alignment:
| Q |
57 |
ggataatattcgtgcttcagctgtttgcaagagatggtgttcagttgccacttctgtacgtgtactcgaccaatcaccttggcttatgtatttcccaaaa |
156 |
Q |
| |
|
||||||| | |||||||| |||||||||||||| ||| || ||||||| | ||||||| | | |||||||||| ||| | |||||||| || ||| |
|
|
| T |
26047365 |
ggataatgtccgtgcttctgctgtttgcaagagttggaattttgttgccaatgctgtacgcatggtgaaccaatcaccatggttgatgtattttccgaaa |
26047266 |
T |
|
| Q |
157 |
attggtaattgttatgatttttatgaccctatgcagcgtaagac-tattcccttgagttgccagagttggatggatgtcgtgtttgctatgcaaaagatg |
255 |
Q |
| |
|
||||| | || ||||| || ||||||||| | ||||| ||||| |||||| ||||||| ||||||||| |||||| | | ||||| || ||||||||| |
|
|
| T |
26047265 |
tttggtcagtggtatgaattctatgaccctgttcagcggaagacctattccattgagtttccagagttgaatggatctagagtttgttacacaaaagatg |
26047166 |
T |
|
| Q |
256 |
gttggttattgctaaaccggc |
276 |
Q |
| |
|
|||||||| ||||| |||||| |
|
|
| T |
26047165 |
gttggttactgctataccggc |
26047145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University