View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13174_low_9 (Length: 299)
Name: NF13174_low_9
Description: NF13174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13174_low_9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 263; Significance: 1e-147; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 263; E-Value: 1e-147
Query Start/End: Original strand, 17 - 287
Target Start/End: Complemental strand, 38911287 - 38911017
Alignment:
| Q |
17 |
attaagtaataaaatgatcaattaaatgtatgtaattagggttctggttcatactgacctgaaaaattagggcatcggaaaattgctcaagacggagata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38911287 |
attaagtaataaaatgatcaattaaatgtatgtaattagggttctggttcatactgacctgaaaaattagggcatcggaaaattgctcaagacggagata |
38911188 |
T |
 |
| Q |
117 |
gatttcgccgagggattgacaagttgtgactaagtgattctccgataagtacttaagcgaaacttcgtagtcgattcggagccatttgagagctttaacg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38911187 |
gatttcgccgagggattgacaagttgtgactaaatgattctccgataagtacttaagcgaaatttcgtagtcgattcggagccatttgagagctttaacg |
38911088 |
T |
 |
| Q |
217 |
tattcacctctgttcttgagtatatcgccgatgacgtttgcccaacgcgcttcttcgcggtggttaccttc |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38911087 |
tattcacctctgttcttgagtatatcgccgatgacgtttgcccaacgcgcttcttcgcggtggttaccttc |
38911017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University