View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13175_high_5 (Length: 262)

Name: NF13175_high_5
Description: NF13175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13175_high_5
NF13175_high_5
[»] chr1 (1 HSPs)
chr1 (7-243)||(4082928-4083164)
[»] chr3 (1 HSPs)
chr3 (103-146)||(48203029-48203072)


Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 243
Target Start/End: Complemental strand, 4083164 - 4082928
Alignment:
7 gtgagatgaatattgtagcgtttgttgtgtttttgtccgtggttgtggcttctttggtgtttgatatcggtgttgtagggggcggcgtcaattttcttct 106  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4083164 gtgacatgaatattgtagcgtttgttgtgtttttgtccgtggttgtggcttctttggtgtttgatatcggtgttgtagggggcggcgtcaattttcttct 4083065  T
107 tcgaaatcgaacactacatagagttgtgattatggcaatgcttgttgctaatcctattagggagaatgaaaaatatagaaatggacctatcaatgaatta 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| ||||     
4083064 tcgaaatcgaacactacatagagttgtgattatggcaatgcttgttgctaatcctattagggagaatgaaaaatttagaaatggacctattaataaattg 4082965  T
207 ttggcattgtcatagggcaatcttcttcccatgacaa 243  Q
    |||||||||||||||||||||||||||||||||||||    
4082964 ttggcattgtcatagggcaatcttcttcccatgacaa 4082928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 103 - 146
Target Start/End: Original strand, 48203029 - 48203072
Alignment:
103 ttcttcgaaatcgaacactacatagagttgtgattatggcaatg 146  Q
    ||||||| ||||||| |||||||| |||||||||||||||||||    
48203029 ttcttcggaatcgaaaactacatatagttgtgattatggcaatg 48203072  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University