View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13175_low_6 (Length: 262)
Name: NF13175_low_6
Description: NF13175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13175_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 7 - 243
Target Start/End: Complemental strand, 4083164 - 4082928
Alignment:
| Q |
7 |
gtgagatgaatattgtagcgtttgttgtgtttttgtccgtggttgtggcttctttggtgtttgatatcggtgttgtagggggcggcgtcaattttcttct |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4083164 |
gtgacatgaatattgtagcgtttgttgtgtttttgtccgtggttgtggcttctttggtgtttgatatcggtgttgtagggggcggcgtcaattttcttct |
4083065 |
T |
|
| Q |
107 |
tcgaaatcgaacactacatagagttgtgattatggcaatgcttgttgctaatcctattagggagaatgaaaaatatagaaatggacctatcaatgaatta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |||| |
|
|
| T |
4083064 |
tcgaaatcgaacactacatagagttgtgattatggcaatgcttgttgctaatcctattagggagaatgaaaaatttagaaatggacctattaataaattg |
4082965 |
T |
|
| Q |
207 |
ttggcattgtcatagggcaatcttcttcccatgacaa |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4082964 |
ttggcattgtcatagggcaatcttcttcccatgacaa |
4082928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 103 - 146
Target Start/End: Original strand, 48203029 - 48203072
Alignment:
| Q |
103 |
ttcttcgaaatcgaacactacatagagttgtgattatggcaatg |
146 |
Q |
| |
|
||||||| ||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
48203029 |
ttcttcggaatcgaaaactacatatagttgtgattatggcaatg |
48203072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University