View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13176_high_7 (Length: 254)
Name: NF13176_high_7
Description: NF13176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13176_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 244
Target Start/End: Original strand, 14085379 - 14085622
Alignment:
| Q |
1 |
gtatgcgtctcttttcttcgtaaaatgtctccaagccattgaaggatgtctatcatgttttcttttctttagttttagcactaactcagcatgttcatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
14085379 |
gtatgcgtctcttttcttcgtaaaatgtctccaagccattgaaggatgtctatcatgttttcttttctttagttttagcactaactcaacatgttcatgt |
14085478 |
T |
|
| Q |
101 |
ccttggcctcgcagtaactcagcagcctcgagactccttgagttctagcaactagaattggaatttgaggcaaaggattcacactggcagtaccactttc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14085479 |
ccttggcctcgcagtaactcagcagcctcgagactccttgagttctagcaactagaattggaatttgaggcaaaggattcacactggcagtaccactttc |
14085578 |
T |
|
| Q |
201 |
catgtgtctnnnnnnncaaaataaataacagaccattagaataa |
244 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14085579 |
catgtgtctaaaaaaacaaaataaataacagaccattagaataa |
14085622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 7 - 109
Target Start/End: Complemental strand, 12189990 - 12189888
Alignment:
| Q |
7 |
gtctcttttcttcgtaaaatgtctccaagccattgaaggatgtctatcatgttttcttttctttagttttagcactaactcagcatgttcatgtccttgg |
106 |
Q |
| |
|
|||| |||||||| |||||||||||||| ||||||||||| ||||| || ||||||||||||||||||||||||||| || |||||||||| |||||||| |
|
|
| T |
12189990 |
gtcttttttcttcataaaatgtctccaaaccattgaaggaggtctagcaggttttcttttctttagttttagcactaccttagcatgttcaggtccttgg |
12189891 |
T |
|
| Q |
107 |
cct |
109 |
Q |
| |
|
||| |
|
|
| T |
12189890 |
cct |
12189888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 209
Target Start/End: Complemental strand, 12189884 - 12189826
Alignment:
| Q |
151 |
actagaattggaatttgaggcaaaggattcacactggcagtaccactttccatgtgtct |
209 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |||||| || ||| ||||||||| |
|
|
| T |
12189884 |
actagaattggaatttgagccaaaggattcacactagcagtatcagttttcatgtgtct |
12189826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University