View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13177_high_14 (Length: 416)
Name: NF13177_high_14
Description: NF13177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13177_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 17 - 405
Target Start/End: Original strand, 42178351 - 42178736
Alignment:
| Q |
17 |
atattcatgtgctcttaagcgtcatggttactccatataatactcacttcatgcatgtgtatgtgtaagagtacatttgaaataatagagtttggaatgg |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42178351 |
atattcatgtgctcttaagcgtcatggttactccata--atactcactccatgcatgtgtatgtgtaagagtagatttgaaataatagagtttggaatgg |
42178448 |
T |
 |
| Q |
117 |
aagaggggaagtgaagtgaattggagtgcaattcacggtttgcaaattgggaatggttgcagacagaagtaaacgttgattagttagataaacgagagag |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42178449 |
aagaggggaagtgaagtgaattggagtgcaattcacggtttgcaaattgggaatggttgcagacagaagtaaacgttgattagttagataaacgagagag |
42178548 |
T |
 |
| Q |
217 |
gtgttgctaagtactttttgcatgcaactctcctttggacctgcacatgaacaaatcaactaagtgcatacaagtatatttaatttatttatttcaaaag |
316 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42178549 |
gtgttgctaagtac-ttttgcatgcaactctcctttggacctgcacatgaacaaatcaactaagtgcatacaagtatatttaatttatttatttcaaaag |
42178647 |
T |
 |
| Q |
317 |
tgaaagtacattttaagaggtcatttttaagaagtacctttgaattttctttcagagtttagagctgagggatgggggctttgatgatg |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42178648 |
tgaaagtacattttaagaggtcatttttaagaagtacctttgtattttcttttagagtttagagctgagggatgggggctttgatgatg |
42178736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University