View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13177_high_27 (Length: 324)
Name: NF13177_high_27
Description: NF13177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13177_high_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 133; Significance: 4e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 133; E-Value: 4e-69
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 668994 - 668858
Alignment:
| Q |
1 |
ttcatttgggcattaggctatgagatattgcttttaaatgggttaggctatgatatattgctttcccatgggaactagatattaaacccattttttattt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
668994 |
ttcatttgggcattaggctatgagatattgcttttaaatgggttaggctatgatatattgctttcccatggaaactagatattaaacccattttttattt |
668895 |
T |
 |
| Q |
101 |
ctcatgctttcttgtgcgctgatttctcaaattgaag |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
668894 |
ctcatgctttcttgtgcgctgatttctcaaattgaag |
668858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 203 - 249
Target Start/End: Complemental strand, 668763 - 668717
Alignment:
| Q |
203 |
aaagatctgttggtaatgttgttgttgctgcttttttattgtgctac |
249 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
668763 |
aaagatctgttggtaatgttgttgctgctgcttttttattgtgctac |
668717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University