View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13177_high_28 (Length: 320)
Name: NF13177_high_28
Description: NF13177
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13177_high_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 307
Target Start/End: Complemental strand, 13715890 - 13715586
Alignment:
| Q |
1 |
ccctcatacattagccgtaaatatcctactttgacggtgctgatacaaaatacgactctttgcattgaacctcaaaatgactgtttgcattggcttcact |
100 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13715890 |
ccctcatacattagccctaaatatcctactttgacggtgctgatacaaaataccactctttgcattgaacctcaaaatgactgtttgcattggcttcact |
13715791 |
T |
|
| Q |
101 |
ctatggatggggatttgtccaacaagttagcttatgattttctgaatacgaatcaagttgagttggtgcaagtttatttgaaatgcctttgtccccaccc |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
13715790 |
ctatggatggggatttgtctaacaagttagcttatgattttctgaatacgaatcaagttgagttggtgcaagtttatttggaatgcctttgtccccaccc |
13715691 |
T |
|
| Q |
201 |
cccacatnnnnnnnnnnnnnnnntcgggccttcatttgtttggagattggctcatcataagcttctaactaatgaccagttacgaataagagggtgtatt |
300 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13715690 |
cccacat--acacacacacacactcgggccttcatttgtttaaagattggctcatcaaaagcttctaactgatgaccagttacgaataagagggtgtatt |
13715593 |
T |
|
| Q |
301 |
ttggtct |
307 |
Q |
| |
|
||||||| |
|
|
| T |
13715592 |
ttggtct |
13715586 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University