View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13178_high_11 (Length: 311)

Name: NF13178_high_11
Description: NF13178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13178_high_11
NF13178_high_11
[»] chr6 (1 HSPs)
chr6 (141-179)||(5375723-5375761)


Alignment Details
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 179
Target Start/End: Original strand, 5375723 - 5375761
Alignment:
141 actaaatctcttttccattttgtgtagtattggaatcaa 179  Q
    |||||||||||||||||||||||||||||||||| ||||    
5375723 actaaatctcttttccattttgtgtagtattggattcaa 5375761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University