View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13178_high_16 (Length: 227)
Name: NF13178_high_16
Description: NF13178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13178_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 139; Significance: 7e-73; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 12 - 211
Target Start/End: Complemental strand, 42548366 - 42548179
Alignment:
| Q |
12 |
gaagaatatgagactgagaaagaggtacgaaactgtaagaaggagaagaaaatgagtttactgatgaacagggtggttgagtcttccttcttcatcatct |
111 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| |
|
|
| T |
42548366 |
gaagaatatgagactgagaaagaggtgagaaactgtaagaaggagaagaaaatgagtttactgatgaacagggtggttgaatcttccttcttcatcgtct |
42548267 |
T |
 |
| Q |
112 |
aatctataagtcatcaattcactccactaaatgcaatttaatctaaacaaaacagataacaaaacacatctaagtttaattaattagaactagatactat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42548266 |
aatctataagtcatcaattcactccactaaatgcaatttaatctaaacaa------------aacacatctaagtttaattaattagaattagatactat |
42548179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University