View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13178_low_11 (Length: 311)
Name: NF13178_low_11
Description: NF13178
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13178_low_11 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 141 - 179
Target Start/End: Original strand, 5375723 - 5375761
Alignment:
| Q |
141 |
actaaatctcttttccattttgtgtagtattggaatcaa |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5375723 |
actaaatctcttttccattttgtgtagtattggattcaa |
5375761 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University